Your privacy, your choice

We use essential cookies to make sure the site can function. We also use optional cookies for advertising, personalisation of content, usage analysis, and social media.

By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection.

See our privacy policy for more information on the use of your personal data.

for further information and to change your choices.
Skip to main content
Figure 1 | EvoDevo

Figure 1

From: Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report

Figure 1

Overview of RIGHT technique used to isolate homologous genes from large gene families. All steps are described in the text. Oligonucleotides that were annealed to make the adapter destroyed the restriction site. All reverse primers were ordered with the 5' end phosphorylated, or were phosphorylated before annealing with an appropriate enzyme. For example, MseI digest/ligation: F-5' GACGATGAGTCTTGAGTTCAGTCTGTA, R-5'PhosTATACAGACTGAACTCAAGACTCATC; XhoI: F-5' GACGATGAGTCTTGAGTTCAGTCTGTA, R-5'PhosTCGATACAGACTGAACTCAAGACTCATC

Back to article page

EvoDevo

ISSN: 2041-9139